|
  
- 积分
- 0
- 威望
- 0
- 包包
- 483
|
作者：Masako Miuraa, Yasuo Miuraa, Hesed M. Padilla-Nashb, Alfredo A. Molinoloc, Baojin Fud, Vyomesh Patelc, Byoung-Moo Seoa, Wataru Sonoyamaa, Jenny J. Zhenge, Carl C. Bakerd, Wanjun Chenf, Thomas Riedb, Songtao Shia作者单位：a Dental Biology Unit, National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, Maryland, USA;b Genetics Branch, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, Maryland, USA;c Oral and Pharyngeal Cancer Branch,
& P+ A* y) J8 y+ ~9 [9 ?* Y: O + _$ u% C7 y7 V4 D* i2 y% A0 a, w! X
5 ?% G& X9 q% G7 V
2 b: k( V) j" T3 D3 X
: p- m% ^. Y$ ^: M+ E" X% Y6 o
3 H$ D# Q: v& V" L
( G+ e) r* K- F& H , ^8 C* q, k( H* W' l% d
" Q- Z( @3 x$ z& f) W- O, E+ E 4 h+ M; W$ j- T+ u: G# a8 Q7 C; L
0 J: M+ x, v% L. @0 l9 F
9 G- [- B: u! f. B! d, I! ~ : {0 d( o D/ S$ e
【摘要】
* E u4 _" K/ R0 F- {# B Despite recent emerging evidence suggesting that cancer stem cells subsist in a variety of tumors, it is not yet fully elucidated whether postnatal stem cells are directly involved in tumorigenesis. We used murine bone marrow¨Cderived mesenchymal stem cells (BMMSCs) as a model to test a hypothesis that tumorigenesis may originate from spontaneous mutation of stem cells. In this study, we demonstrated that murine BMMSCs, after numerous passages, obtained unlimited population doublings and proceeded to a malignant transformation state, resulting in fibrosarcoma formation in vivo. Transformed BMMSCs colonized to multiple organs when delivered systemically through the tail vein. Fibrosarcoma cells formed by transformed BMMSCs contained cancer progenitors, which were capable of generating colony clusters in vitro and fibrosarcoma in vivo by the second administration. The mechanism by which BMMSCs transformed to malignant cells was associated with accumulated chromosomal abnormalities, gradual elevation in telomerase activity, and increased c-myc expression. Moreover, BMMSCs and their transformed counterpart, fibrosarcoma-forming cells, demonstrated different sensitivity to anti-cancer drugs. BMMSCs/fibrosarcoma transformation system may provide an ideal system to elucidate the mechanism of how stem cells become cancer cells and to screen anti-sarcoma drugs. % d }1 F8 ?* t2 B
【关键词】 Bone marrowCderived mesenchymal stem cell Malignant transformation Chromosomal instability Fibrosarcoma
1 A6 v# e( H- U* j6 Y* e2 X INTRODUCTION1 N: F7 [) m) u s, B0 J7 l
' Q, K6 b+ q6 G# _# |& b
Recently, the possibility that tumors originate from cancer stem cells has been proposed based on the fact that only a small percentage of cancer cells form tumors and that tumor cells exhibit stem cell properties such as hierarchical self-renewal, unlimited proliferation, differentiation capabilities, and use of stem cell¨Cassociated signaling pathways to maintain "stemness" , implying the possibility of spontaneous immortalization of murine BMMSCs under similar culture conditions.
9 y/ W; D( Z4 ?: d2 O/ @4 p; L" H: T# g) q- {
In the meantime, multipotent adult progenitor cells (MAPCs) were discovered as an infrequent population of BMMSCs maintained in the adult bone marrow compartment . They are considered an extremely important stem cell resource for regenerative medicine because they were reported to possess pluripotent stem cell characteristics, similar to embryonic stem cells (ESCs); they differentiate into endoderm-, mesoderm-, and ectoderm-derived cells and proliferate extensively without entering into senescence. However, it is important to further verify characteristics of the cells with extensive proliferation in adult bone marrow.; `: X: I2 k+ p7 i
I$ _, z% V4 l! W) q8 ]
In this study, we found that continuous passages led BMMSCs to spontaneous immortalization. After additional passages, the immortalized BMMSCs became transformed into malignant cells, capable of forming fibrosarcomas in vivo, at least partially, due to accumulated chromosomal abnormalities, amplified c-Myc expression, and elevated telomerase activity. This consecutive conversion of BMMSCs to malignant cells provides an excellent model to study the mechanisms associated with the tumorigenic potential of postnatal stem cells and explore therapeutic strategies for malignant tumors.7 s& y2 E! } @
8 A: C0 E( n# k' ?! x
MATERIALS AND METHODS7 {% P( v, y: `+ d
( s3 m/ i d8 }9 v% cMouse BMMSC Culture
' H: Y" V: k4 }6 T6 ]4 B8 R ?8 p4 |
Preparation and expansion of the murine BMMSCs was done based on a published method .. z5 @. E( f6 \. M; x
4 b0 ~. V; ~8 ~2 [; JHuman MSC Culture/ d7 Y- P' n/ a& X; M
$ U) W" l9 J5 Q$ `" A/ K
Human bone marrow aspirates from healthy adult volunteers were purchased from AllCells, LLC (Berkeley, CA, http://www.allcells.com). To identify putative BMMSCs, single-cell suspension of 1 x 106 of bone marrow mononuclear cells was seeded into 15-cm culture dishes and nonadherent cells were removed after 4 hours of incubation at 37¡ãC. The adherent cells were cultured with -MEM supplemented with 15% FBS, 100 µM L-ascorbic acid 2-phosphate (Wako Pure Chemical Industries Ltd., Osaka, Japan, http://www.wako-chem.co.jp), 2 mM L-glutamine, and a combination of 100 U/ml penicillin and 100 µg/ml streptomycin. BMMSCs were plated at 1:4 dilution when the cells were approaching confluence. Isolation of dental pulp stem cells and periodontal ligament stem cells was described as previously . They were cultured in the same medium as that used for human BMMSCs and plated at 1:4 dilution when the cells were approaching confluence.
& _7 k4 z& `3 N0 @8 F, x, n+ [2 ~3 C+ \' X; k+ V) f4 ?4 a8 p
Transplantation and Injection of BMMSCs7 }: L* Q" E) u2 B p
?# ^/ c; d& J9 _! ?; i* y
Approximately 2¨C4 x 106 of murine BMMSCs were transplanted into 6- to 8-week-old immunocompromised (bg-nu/nu-xid) mice using hydroxyapatite/tricalcium phosphate (HA/TCP) ceramic powder (Zimmer, Inc., Warsaw, IN, http://www.zimmer.com) and harvested 8 weeks after transplantation . To assess tumorigenesis and migration potential, 1 x 106 of BMMSCs were injected into bg-nu/nu-xid mice subcutaneously and intravenously through tail vein, respectively. In some experiments, tumor cells were dispersed by digesting tumors with 3 mg/ml collagenase type I (Worthington Biochem, Freehold, NJ, http://www.worthington-biochem.com) and 4 mg/ml dispase (Boehringer Mannheim, GmbH, Mannheim, Germany, http://www.boehringer.com). Then tumor cells were injected subcutaneously into second-recipient bg-nu/nu-xid mice. These procedures were performed in accordance with an approved small-animal protocol (National Institute of Dental and Craniofacial Research no. 04¨C317).
6 o* n- y8 x5 e
& M& q5 P6 ?" }: o1 k0 ?9 jHistological Analysis
" g1 w! P+ q' S8 z4 h% q. }( q4 y
) B; ^. t' e* q4 i# H/ q2 vTransplants were harvested and demineralized with 10% EDTA before embedding. The paraffin-embedded sections were stained with hematoxylin and eosin, or Mallory trichrome, or incubated with the antibodies for vimentin (Zymed Laboratories, Inc.) and cytokeratin (DakoCytomation, Glostrup, Denmark, http://www.dakocytomation.com).
, r4 t3 [7 w) v& [! A4 A1 F! u( m2 w* q" ^: B$ X
Fluorescence-Activated Cell Sorting Analysis
) |7 G5 \' N! t( c3 w& T* e6 \( E1 H: `; p# @& a+ b' g
Cells (1 x 106) were incubated with 1 µg of phycoerythrin (PE)-conjugated antibodies for 45 minutes at 4¡ãC. PE-conjugated isotype-matched immunoglobulin G (IgG) was used as control. Antibodies against CD45, TER119, CD13, Sca-1, Thy-1, CD34, c-kit, CD19, CD3, and CD18 were from BD Biosciences (San Diego, http://www.bdbiosciences.com), and SSEA-1 and Flk-1 were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, http://www.scbt.com).
$ u( U8 |. J: Q5 P, Z7 G
0 Z6 ~* j* V6 V% E; w' OSpectral Karyotyping and Fluorescent In Situ Hybridization
( e, M# r: S2 A
1 e' y5 S7 W% M& g$ Z5 a2 ?9 |$ ]! EMetaphase chromosomes for spectral karyotyping (SKY) hybridization were prepared from BMMSCs at different passages. Cells in culture were incubated for 1¨C2 hours in 0.02 mg/ml Colcemid (Invitrogen, Carlsbad, CA, http://www.invitrogen.com). The cells were incubated in hypotonic solution (0.075 M KCl) and fixed in methanol/acetic acid (3:1). SKY was then performed as described previously, using a combination of five different fluorochromes . Images were acquired with Sky acquisition software (Applied Spectral Imaging, Ltd, Migdal Haemek, Israel, http://www.spectral-imaging.com) using a spectral cube and a CCD (charge-coupled device) camera (Hamamatsu, Bridgewater, NJ, http://jp.hamamatsu.com) connected to a DMRXA microscope (Leica Imaging Systems, Cambridge, U.K., http://www.leica.com) with a custom SKY-3 optical filter (Chroma Technology Corp., Rockingham, VT, http://www.chroma.com). A minimum of 10 metaphases were imaged and karyotyped using SkyView version 1.6.2 software. To confirm the origin of the double-minute chromosomes detected by SKY, dual-color fluorescent in situ hybridization (FISH) was performed with a chromosome-painting probe for chromosome MMU15 and the c-myc gene. DNA was isolated from the BAC clone for c-myc (D15Mit17) and labeled with biotin-16-dUTP (Roche BioMolecular, Indianapolis, https://www.roche-applied-science.com) using a standard nick-translation protocol. Chromosome-painting probe for MMU15 (directly labeled with CyTm5) used for FISH hybridizations was prepared using the same protocols as for labeling of SKY chromosome-painting probes (http://www.riedlab.nci.nih.gov/protocols.asp). FISH probe for c-myc was labeled by Nick translation with biotin-16-dUTP (Roche BioMolecular) and visualized using CW4000 FISH software (Leica Imaging Systems). The condition for hybridization was as described in http://www.riedlab.nci.nih.gov/protocols.asp.& m* n' x9 O& g6 H
2 j* j. ?9 |, \5 Z; M
Western Blot Analysis# Z& r4 x9 b5 K/ d
1 J5 H* i9 O5 o
Cells were lysed in mammalian protein extraction reagent (Pierce Chemical Co., Rockford, IL, http://www.piercenet.com). Ten micrograms of protein per each lane was separated by SDS-PAGE, transferred to a nitrocellulose membrane, and probed with c-Myc (Santa Cruz Biotechnology, Inc.) and ß-actin (Sigma, St. Louis, http://www.sigmaaldrich.com). Bound antibodies were revealed with goat anti-mouse IgG conjugated to horseradish peroxidase (HRP) (Santa Cruz Biotechnology, Inc.), and blots were developed using Super Signal chemiluminescence HRP substrate (Pierce Chemical Co.)." }0 l: \( K* e! Y0 L3 ^ l' Q
N3 ~9 H* m* ^5 ^Quantitative Telomerase Activity Assay7 O. h% T4 }2 K: V
: j& o0 H; @* i/ Z2 R$ A2 M5 ]
The telomerase activity was evaluated using the two-step quantitative-PCR-based telomeric repeat amplification protocol assay as reported previously with slight modification . Briefly, 40 µl of first-step reaction mixture, which contained 2.0 µg of cell lysate diluted into 26 µl of 0.1 mg/ml bovine serum albumin, 1X TRAP standard reaction buffer, 50 µM each deoxynucleotide triphosphate, 0.1 µg of TS oligonucleotide substrate (TS primer; AATCCGTCGAGCAGAGTT), and 0.2 µg of T4 gene protein (Amersham Pharmacia Biotech, Piscataway, NJ, http://www.amersham.com) was incubated at 33¡ãC for 5 hours and 95¡ãC for 10 minutes. Sybr Green real-time Q-PCR assays (Applied BioSystems, Foster City, CA, http://www.appliedbiosystems.com) were carried out using 25 µl of volume containing 1.0 µl of the product from the first step and 300 nM TS and ACX primers (ACX primer; GCGCGGCTTACCCTTACCCTTACCCTAACC). Standard curve was produced for the assay using serially diluted 293 cell extracts, and all samples were run in triplicate.
: R+ i5 q8 j, \3 T
4 O6 T- T& B) H1 D- @, ^0 vTelomere Length Assay, d$ l* {3 z Q. B5 U
3 J% d9 W. S$ x
Genomic DNA was purified from BMMSCs using a High Pure PCR Template Preparation Kit (Roche Applied Science, Mannheim, Germany, http://www.roche-applied-science.com). Telomere length was assessed by Telo TAGGG Telomere Length Assay kit (Roche Applied Science) according to the manufacturer¡¯s protocol.
/ ]3 n! C$ z: W0 L" w) f" F- J% V; b$ Z! L
Anti-Cancer Drug Treatment
_+ _( @! \ B. K% e# W. M7 D7 u0 j) r/ N
BMMSCs at P1 and transformed BMMSCs at P63 seeded in 96-well plates were treated with etoposide (0¨C1,000 µg/ml; Alexis Biochemicals, San Diego, http://www.axxora.com, http://sigmaaldrich.com) and doxorubicin (0¨C30 µg/ml; Sigma) for 48 hours at 37¡ãC. Cell viability was measured by using the Cell Counting Kit-8 from Dojindo Molecular Technologies, Inc. (Gaithersburg, MD, http://www.dojindo.com) according to the manufacturer¡¯s protocol. The inhibition effects of drugs (percentage of control) were calculated as (absorbance of non-treated cells x absorbance of treated cells)/absorbance of non-treated cells. Median effective concentration (EC50) is the drug concentration at which the cell viability becomes 50% of non-treated cells. The experiments were repeated three times. The representative plates were scanned after the reaction.
: t% v! Q4 `% B9 e& |; e0 e& V4 W
& J' d% {1 U7 r2 @RESULTS* |$ O5 p; G9 s/ x b
) h) O9 ]* u, x9 L8 cBMMSCs Were Spontaneously Transformed into Malignant Cells by Continuous Passage In Vitro% \: N: N3 ]1 _6 E S
0 w7 k! f) ]: Q3 ^5 NBMMSCs from adult C57Bl/6 mice were passaged continuously for more than 1 year and obtained unlimited population doublings (Fig. 1A). After additional passages, BMMSCs gradually acquired increased proliferating capacity as shown by BrdU incorporation (Fig. 1B). Initially, BMMSCs at P0 formed single-colony clusters (Fig. 1C) and showed multiple in vitro differentiation capabilities to become osteogenic (Fig. 1D), adipogenic (Fig. 1E), and chondrogenic cells (Fig. 1F) under various inductive conditions . At P13, BMMSCs still maintained a large cell morphology (Fig. 1H) but failed to generate any mineralized tissues in vivo (Fig. 1L), suggesting that BMMSCs have lost their osteogenic differentiation potential after they overcome the crisis phase and acquired proliferating capacity. With further continued passages (P29), the cells became smaller (Fig. 1I) and generated tumors upon in vivo transplantation (Fig. 1M). Moreover, as the passage number increased to P54, the cells showed a significantly smaller morphology (Fig. 1J) and formed tumors with a shorter latent period after transplantation compared with P29 (Fig. 1N), indicating a higher degree of malignancy.1 s3 `. o! k3 E, J2 ?
9 a( N: c! K! t9 Q, T' f+ w
Figure 1. Murine BMMSCs were transformed into malignant cells. (A): BMMSCs were cultured under standard conditions and maintained for 1 year with more than 100 passages. They were considered immortalized cells. (B): The proliferation rate was assessed by BrdU incorporation for 4 hours. The number of BrdU-positive cells was expressed as a percentage of the total number of counted cells at the indicated passages. BMMSCs at later passages showed a higher proliferating rate in comparison with BMMSCs at earlier passages with significant statistical difference (*p ' i4 Q+ O S8 l( t8 D: f" w
' [) \; w1 O( x9 I2 p* G! o- S
Transformed BMMSCs Generated Fibrosarcomas and Colonized in Multiple Organs In Vivo
5 ^) ?: U& o- W4 X1 G2 a+ y" @& t4 e5 O, O
The tumors generated by transformed BMMSCs were composed of spindle-shaped and round atypical cells and extensively invaded the surrounding muscles and subcutaneous tissues (Fig. 2A). The blue cytoplasmic staining of tumor cells by Mallory trichrome staining suggested fibroblastic differentiation (Fig. 2B). In addition, the positive staining for vimentin (Fig. 2C) and the negative staining for cytokeratin (Fig. 2D) by immunohistochemical analysis revealed their mesenchymal origin. Taken together, these tumors generated by transformed BMMSCs were diagnosed as fibrosarcomas. BMMSCs have been shown to integrate into multiple organs after systemic administration known as "homing" .
& K! b0 ^3 u i) E" y
. O) ~" [. m' K4 F* xFigure 2. Transformed BMMSCs generated fibrosarcomas and colonized in multiple organs. (A¨CD): Histology of tumors generated by BMMSCs at P67. Tumors were composed of spindle and round atypical cells and invasive to surrounding muscles (arrow). Mitosis of nuclei was also observed (yellow arrow) (A). Mallory trichrome staining showed fibroblastic differentiation of tumor cells (blue staining). Red color staining (arrows) indicated the muscles (B). Immunohistochemical staining using anti-vimentin antibody indicated that the tumor cells originated from mesenchymal cells (arrow heads) (C). Negative staining using anti-cytokeratin antibody (star) excluded the possibility of epithelial cell origin of the tumor cells. Skin epidermal tissues were positive for cytokeratin (arrows) (D). Original magnification: x200 (A¨CD). (E¨CH): Hematoxylin and eosin staining of transformed BMMSCs at P65 showed tumor formation (T) in alveolar spaces of lungs (L, ), kidney (F), mediastinum (G), and vertebrae (H) after i.v. injection into mice. Gromelurus (G), renal tubules (Tu), trachea (Tr), tracheal cartilages (TC), and bone (B). Original magnification: x200 (E¨CH). (I): Single cells from dispersed fibrosarcomas formed colonies in vitro when 1 x 106 cells were inoculated. (J): Single cells from dispersed fibrosarcomas re-formed tumors in the second recipients when 1 x 106 cells were inoculated. (K): FACS analysis indicated that transformed BMMSCs were positive for CD13 and Sca-1 but negative for Thy-1, SSEA-1, Flk-1, and hematopoietic markers CD45, TER119, CD18, CD19, CD3, c-kit, and CD34. Abbreviations: BMMSC, bone marrow¨Cderived mesenchymal stem cell; FACS, fluorescence-activated cell sorting; P, passage.
- R: |! p1 B( T7 L3 }- X) j8 T; l' b& S0 a
Transformed BMMSCs at P57 sustained the expression of CD13 and Sca-1 (Fig. 2K) but lost the expression of Thy-1, SSEA-1, and Flk-1 expressed in BMMSCs at P1 (data not shown). Hematopoietic cell markers, CD45, TER119, CD18, CD19, CD3, c-kit, and CD34, were negative in BMMSCs at both P57 and P1. These findings indicated that the transformation process changed the expression pattern of surface markers in BMMSCs, but some markers expressed in BMMSCs at P1 were still maintained.
3 a4 Q* n9 Z$ W& p/ o3 U: C( `/ G7 e
To further clarify the features of BMMSC at the single-cell level, single colony¨Cderived BMMSCs were isolated and their immortalization and transformation potentials were assessed. We found that five out of 100 single colony¨Cderived BMMSCs became immortalized. All of the immortalized clones maintained in vitro osteogenic differentiation potential and four out of five clones maintained in vitro adipogenic differentiation potential at early passages (Table 1). Four out of five of these clones were eventually transformed to generate fibrosarcoma after a subcutaneous inoculation (Table 1). One of them, clone C3, showed significant bone differentiation within the newly formed fibrosarcoma (Table 1). However, when transplanted with HA/TCP, two more clones (clone D2 and H8) also generated bone after they acquired tumor formation capacity (Table 1). These findings suggest that not only multicolony-derived BMMSCs, but also single colony¨Cderived BMMSCs, become transformed and that some cells in transformed clones partially maintain their differentiation capability, probably depending on the environment and the cell stages.
* [1 C: V( {' S0 G' \: K/ j
1 j, ?6 g5 \$ j& o& j, J) E( ^6 D, b1 KTable 1. Characteristics of single colony¨Cderived bone marrow¨Cderived mesenchymal stem cell (BMMSC) clones, @" n J/ E& W" W
2 G7 B$ F* v9 q; I+ K# c* g0 WAccumulated Chromosomal Abnormalities Were Associated with the Transformation of BMMSCs
1 |* J6 L5 ~. s: K1 i2 z* {; \! v5 H6 K; E- q' p9 H' P
It has been postulated that genome instability is critical for tumor formation . The quantitative assay indicated that BMMSCs at P1 had little telomerase activity compared with the HEK293 cells used as a positive control, but after continuous passages, BMMSCs gradually gained increased telomerase activity (Fig. 3E). Non-transformed BMMSCs and transformed BMMSCs showed similar telomere lengths (Fig. 3F), suggesting that telomere length was maintained by telomerase activity during the immortalization and transformation process. These findings suggested that amplification of c-myc was, at least in part, involved in the transformation of BMMSCs through upregulated telomerase activity.
; _# E$ ]' M, M0 |/ ~- `0 F3 S" {. T/ } V4 e: W# |$ W8 A3 a
Table 2. The numerical chromosomal aberrations observed in 10 analyzed cells in P27 and P55& E7 y7 |& {% k0 D4 k8 P! q3 l9 v
1 r" V6 h2 s: F7 lFigure 3. Chromosomal abnormalities in transformed BMMSCs. (A): SKY analysis of BMMSCs at P27 showed a gain of chromosome MMU2 and double-minute chromosomes involving MMU15 (yellow arrow). (B): SKY analysis of BMMSCs at P55 indicated a significant increase in the number of double minutes involving MMU15 (yellow arrow). Deletion in MMU14 and a loss of MMU8 were noted. (C): FISH analysis revealed an amplification of c-myc (yellow arrows) located on MMU15 (white arrows). (D): Western blot analysis confirmed the upregulated expression of c-Myc in BMMSCs at P14, P29, and P54 when compared with BMMSCs at P1. (E): BMMSCs gradually gained significant telomerase activity after continuous passages (*p
& s. U; _. _- C7 {: r& r+ W# q7 G* l8 j0 z" v q, T4 I E/ _
Transformation System of BMMSCs Can Be Used as a Model for Screening of Anti-Cancer Drugs
/ A( K1 h$ P6 {, S! n% a) n- ]) W" y) o6 k: F1 G9 z
Here, we showed that transformed BMMSCs had quite different characteristics from their parental BMMSCs. We selected two anti-cancer drugs, etoposide and doxorubicin, to compare how transformed BMMSCs and their parental BMMSCs might respond to treatment. After treatment with etoposide for 48 hours, the drug concentrations to suppress the cell viability to 50% of 21.20 µg/ml non-treated cells as a control (EC50) are 185.54 ¡À and 1.07 ¡À 0.07 µg/ml (mean ¡À SD) for BMMSCs at P1 and P63, respectively (Fig. 4A, 4B). The inhibitory curves of etoposide to BMMSCs at P1 and P63 were significantly separated (Fig. 4B), indicating that the therapeutic effect of etoposide may be achieved without causing a severe toxic effect on normal BMMSCs at a wide range of concentrations. In contrast, the inhibitory curves of doxorubicin to BMMSCs at P1 and P63 were very close. The mean EC50 values of doxorubicin to BMMSCs at P1 and P63 were 0.49 ¡À 0.18 µg/ml and 0.16 ¡À 0.05 µg/ml, respectively (Fig. 4C, 4D), suggesting that the toxicity was relatively significant because there was no separation between "toxicity curve" (the inhibitory effect on BMMSCs at P1) and "effective curve" (the inhibitory effect on BMMSCs at P63). These findings may correlate with the fact that doxo-rubicin has adverse side effects on patients, such as the damage to cardiac muscles and the suppression of bone marrow function. Taken together, this system suggests a unique model for in vitro screening to select drugs and determine appropriate dosages to target transformed stem cells without severe side effects on normal stem cells.
. J8 c0 _( v" |3 O K/ ]' V" K. o8 y. M! K( a& L; `1 K! z+ _0 L
Figure 4. Normal and transformed bone marrow¨Cderived mesenchymal stem cells (BMMSCs) responded differently to anti-cancer drugs. Cell viability of BMMSCs at passage 1 (P1) and P63 was evaluated after anti-cancer drug treatment. (A, B): Treatment with etoposide (0¨C1,000 µg/ml) for 48 hours. BMMSCs at P1 and P63 seeded in 96-well plates were treated with the indicated concentration of etoposide. The representative plate demonstrated gradual changing of color with increased concentrations of etoposide. The change of color was more drastic in P63 than in P1 (A). The inhibitory curves to BMMSCs at P1 (black solid line) and P63 (blue dotted line) were significantly separated, indicative of a wide therapeutic index (B). (C, D): Treatment with doxorubicin (0¨C30 µg/ml) for 48 hours. The color of plate was changed similarly at P1 and P63 (C). There was no separation between "toxicity curve" (the inhibitory effect on BMMSCs at P1) and "effective curve" (the inhibitory effect on BMMSCs at P63) (D).1 h: [ b8 V0 ]4 S4 v& C
- r" J; r+ _$ i( K
DISCUSSION
* I" T2 E/ k- ]6 W
4 z6 X* c& r& J: |* z( iThis study is the first report to show that murine BMMSCs can generate fibrosarcomas in vivo after spontaneous transformation into malignant cells. We clearly demonstrated the process from stem cells to malignant cells. Despite the assumption that the origin of cancer stem cells are related to postnatal stem cells, there has been no direct evidence to demonstrate that postnatal stem cells are involved in tumorigenesis. Here, we provide direct evidence to show that murine BMMSCs could evolve into malignant tumors by spontaneous conversion of BMMSCs to transformed cells. The mechanism, by which BMMSCs are transformed into malignant cells, is correlated with accumulated chromosomal abnormalities, including structural and numerical aberrations, with increased passage numbers. Our data, including proliferation assay, histological analysis, chromosomal analysis, and quantitative telomerase activity assay, suggest that alteration of genome stability is a dynamic process, which may play a critical role to determine the fate of BMMSCs. More importantly, we showed that the double-minute chromosomes were present in the transformed BMMSCs, perhaps associated with elevated expression of c-Myc. Although many studies on human and murine cells have demonstrated a strong association between overexpression of c-Myc and tumorigenesis, this study is the first report to indicate that double-minute chromosomes were developed during the transformation process of postnatal stem cells. In addition, we found that the tumors formed by transformed BMMSCs were pathologically identified as fibrosarcomas. Transformed BMMSCs, which are a small population (5 of 100 single cell¨Cderived clones) of adult BMMSCs, demonstrated unlimited population doublings, partially maintained differentiation capabilities in vivo, colonized in multiple organs after systemic injection, and obtained telomerase activity. These phenotypes are similar to MAPCs although transformed BMMSCs partially shared the expression profile of cell surface markers with MAPCs .
& u6 C5 _. X; A
" ]; W6 u0 y" H, [7 h, p% hIt is important to point out that the immortalization and transformation processes seen in murine BMMSCs were not observed in human BMMSCs under our culture conditions. To evaluate the potential of human BMMSCs to become spontaneously immortalized, we used similar strategies to find that in vitro cell culture with continuous passages led human BMMSCs to senescence without any sign of immortalization (data not shown). Human BMMSCs at P17, which had almost reached senescence, showed a very slow growth rate and demonstrated normal chromosomes (46, XX) in 14 of 15 analyzed cells, with only one revealing two non-clonal structural aberrations, deletion of chromosome 9 and 10 (data not shown). Therefore, human BMMSCs at the very latest stage of their life span are still capable of maintaining fidelity of chromosomal segregation. We tested not only human BMMSCs but other human MSCs, including dental pulp stem cells . The discrepancy between the reported finding and our observation in human BMMSCs may be due to the different experimental conditions or the origin of donors. If human BMMSCs can be spontaneously transformed to malignant cells, the clinical applications of BMMSCs for tissue engineering should be conducted very carefully and new therapeutic approaches will have to be developed to target transformed BMMSCs. Thus, understanding the mechanisms of how BMMSCs are transformed to malignant cells is critical for providing new insight into therapeutic strategies when human stem cells are applied for clinical therapies.( r; X: a4 d1 q! Z! n+ g, A1 D' y: |
8 h) U1 G' ^, E4 ?9 V$ D* \
Spontaneous immortalization/malignant transformation in our system may mimic the process of tumorigenesis in human body. Also, the comparison of BMMSCs with transformed BMMSCs derived from their parental normal BMMSCs makes this system unique to compare the response to the drugs at different stages. We attempted to use this BMMSCs/fibrosar-coma transformation system to screen anti-cancer drugs for identifying a therapeutic index. The response of malignant cells and normal cells to drug treatment represents the effectiveness and the toxicity of the tested drug, respectively. After in vitro treatment, the EC50 of etoposide to normal BMMSCs at P1 was more than 170 folds higher than EC50 to transformed BMMSCs at P63, suggesting that etoposide has a wide therapeutic index. In contrast to etoposide, doxorubicin showed a very close EC50 between normal BMMSCs and transformed BMMSCs. These data suggest doxorubicin is more toxic than etoposide due to less specific effects on malignant cells. Indeed, this finding corresponds to the fact that doxorubicin causes worse side effects, such as the damage to cardiac muscles and the suppression of bone marrow function. It is suggested that, taken together, this system has the potential to provide a useful model for in vitro drug screening. This may help us to examine newly developed drugs and select more appropriate drugs and dosages while avoiding severe side effects.& m9 [" _" e" E' v8 g
& V( F2 p7 r9 {In summary, we demonstrated that murine BMMSCs become spontaneously transformed with accumulated chromosomal abnormalities, including double-minute chromosomes, and form fibrosarcoma in vivo. Our BMMSCs/fibrosarcoma transformation system may be useful for drug screening as well as for further investigation of the mechanisms by which BMMSCs become transformed to establish stem cell¨Cbased therapies.
5 U8 Z9 `0 K: k6 d1 y3 f3 P8 d3 r$ I- E& t( P2 P9 s
ACKNOWLEDGMENTS) O h3 {# S7 }' _# K" \! p5 M9 `* S
5 V9 s# A3 h/ `0 ~. [
We thank Nicole McNeil (Genetics Branch, Center for Cancer Research, National Cancer Institute) for preparation of the c-myc probe for FISH analysis, Linda Barenboim Stapleton (Genetics Branch) for preparation of our mouse SKY probes, and Sivio Gutkind (Oral and Pharyngeal Cancer Branch/National Institute of Dental and Craniofacial Research) for critical reading and review of this manuscript. This work was supported by the intramural program of National Institute of Dental and Craniofacial Research, National Institutes of Health, Department of Health and Human Services.
! H+ u, E9 V8 {
) p1 i# ^7 b0 u9 ^* iDISCLOSURES
|% F9 c: J% p. J, C5 y- @# N
% C4 G& m+ a& A' u' LThe authors indicate no potential conflicts of interest." X, V5 p, F. K2 x. J7 L
【参考文献】( z, h( C- o. k: `8 L
" Z* X% u1 s1 t5 O) `" |- {6 x
* e0 L3 o. D& _( z! _
Pardal R, Clarke MF, Morrison SJ. Applying the principles of stem-cell biology to cancer. Nat Rev Cancer 2003;3:895¨C902.% `' @5 U7 M: S4 y1 C
$ R! b0 W+ O; x" W9 a1 ]Lapidot T, Sirard C, Vormoor J et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature 1994;367:645¨C648.8 S7 D3 g- z2 |, B
4 s* V, u. d, k: c: C- [
Bonnet D, Dick JE. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat Med 1997;3:730¨C737.
0 G& X1 P) L, V' M E% ^5 l1 R6 z2 `$ j- T1 i8 S! y2 r
Hope KJ, Jin L, Dick JE. Acute myeloid leukemia originates from a hierarchy of leukemic stem cell classes that differ in self-renewal capacity. Nat Immunol 2004;5:738¨C743.
* o2 B4 F0 F/ z7 q$ j( Y: K7 R* U3 |5 F8 f( n. W6 l
Al-Hajj M, Wicha MS, Benito-Hernandez A et al. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A 2003;100:3983¨C3988.
& L; q+ a$ \6 X! a: V6 `* |: B. p5 I' G$ A$ a9 A
Singh SK, Clarke ID, Terasaki M et al. Identification of a cancer stem cell in human brain tumors. Cancer Res 2003;63:5821¨C5828.
$ j- Q: M6 W) K: @/ u2 I
' C" a, O* X! m( hSingh SK, Hawkins C, Clarke ID et al. Identification of human brain tumour initiating cells. Nature 2004;432:396¨C401.
7 ^% h- g! t1 y0 ?! D2 j. `6 s' I& o5 q
Houghton J, Stoicov C, Nomura S et al. Gastric cancer originating from bone marrow-derived cells. Science 2004;306:1568¨C1571.8 u9 B* w) P: B: b8 [
. p" G0 O d% ^+ G' X
Rubio D, Garcia-Castro J, Martin MC et al. Spontaneous human adult stem cell transformation. Cancer Res 2005;65:3035¨C3039.3 d3 Z- I4 F" j8 L2 f' @/ v
; ~% z* Z7 @1 V( k4 n& j
Todaro GJ, Green H. Quantitative studies of the growth of mouse embryo cells in culture and their development into established lines. J Cell Biol 1963;17:299¨C313.7 g- @ R" h" ?# l7 l
8 S- e1 Q4 y! ]Jiang Y, Jahagirdar BN, Reinhardt RL et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 2002;418:41¨C49.8 k% L( h1 @7 W# Y* U b
* E1 Z$ T8 g4 u3 sMiura M, Chen XD, Allen MR et al. A crucial role of caspase-3 in osteogenic differentiation of bone marrow stromal stem cells. J Clin Invest 2004;114:1704¨C1713.( y' u9 O' q) W9 m8 p/ z. j/ X9 _
& o7 K0 l! l. pShi S, Gronthos S, Chen S et al. Bone formation by human postnatal bone marrow stromal stem cells is enhanced by telomerase expression. Nat Biotechnol 2002;20:587¨C591.
$ o0 h$ ?/ D! {2 D* q. m3 z( y
+ I' i7 T1 |7 P( c( K& U3 m7 RLee HS, Huang GT, Chiang H et al. Multipotential mesenchymal stem cells from femoral bone marrow near the site of osteonecrosis. STEM CELLS 2003;21:190¨C199.- I( g: I% z, P3 J# W" Z* y
. G5 r! v" l1 x+ G; z, }9 KGronthos S, Mankani M, Brahim et al. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc Natl Acad Sci U S A 2000;97: 13625¨C13630.6 j3 U% d- F I% b
4 [6 ~2 R1 x# l0 q" J
Seo BM, Miura M, Gronthos S et al. Investigation of multipotent post-natal stem cells from human periodontal ligament. Lancet 2004;364: 149¨C155.. B z$ e; u4 K
( l" S" u# Z( f6 q* [2 G
Krebsbach PH, Kuznetsov SA, Satomura K et al. Bone formation in vivo: Comparison of osteogenesis by transplanted mouse and human marrow stromal fibroblasts. Transplantation 1997;63:1059¨C1069.
# v) M E, n |
?8 E7 ]: h. T& a3 iSchrock E, du Manoir S, Veldman T et al. Multicolor spectral karyotyping of human chromosomes. Science 1996;273:494¨C497.+ V q6 M$ F9 P
9 u% M7 K& e0 g0 j: ^* E0 NLiyanage M, Coleman A, du Manoir S et al. Multicolour spectral karyotyping of mouse chromosomes. Nat Genet 1996;14:312¨C315. X: }9 r( o9 c, q! j0 E
|& x( d6 M# r: h0 i' S) a2 C; d2 ?
Fu B, Quintero J, Baker CC. Keratinocyte growth conditions modulate telomerase expression, senescence, and immortalization by human papillomavirus type 16 E6 and E7 oncogenes. Cancer Res 2003;63:7815¨C7824.
+ G+ r0 r+ W8 {
5 B4 V8 _! `8 |( OFriedenstein AJ, Chailakhyan RK, Latsinik NV et al. Stromal cells responsible for transferring the microenvironment of the hemopoietic tissues. Cloning in vitro and retransplantation in vivo. Transplantation 1974;17:331¨C340.
1 i, g& _5 \6 e0 \* V3 r. \6 r7 s4 H/ Q! S8 O- ^
Owen M, Friedenstein AJ. Stromal stem cells: Marrow-derived osteogenic precursors. Ciba Found Symp 1988;136:42¨C60.
3 ?9 I+ ]- y3 d% J! s/ y+ d9 E3 u* P8 @% q
Prockop DJ. Marrow stromal cells as stem cells for nonhematopoietic tissues. Science 1997;276:71¨C74.
# k* g' l. ]! |; g8 V# y; c
/ |0 \% T- B' H$ xPittenger MF, Mackay AM, Beck SC et al. Multilineage potential of adult human mesenchymal stem cells. Science 1999;284:143¨C147.+ P7 N B$ F' ~: z4 I
' k& W% z3 d! p- M/ WLiechty KW, MacKenzie TC, Shaaban AF et al. Human mesenchymal stem cells engraft and demonstrate site-specific differentiation after in utero transplantation in sheep. Nat Med 2000;6:1282¨C1286.# f6 o7 O2 S9 P' U& Q- ^$ ]7 K1 c
, s0 j) V" q* I% L' SFeldser DM, Hackett JA, Greider CW. Telomere dysfunction and the initiation of genome instability. Nat Rev Cancer 2003;3:623¨C627.5 j0 l2 T6 S! M! ?
) s1 l( P2 q( O$ w7 t# f" c2 fMathon NF, Lloyd AC. Cell senescence and cancer. Nat Rev Cancer 2001;1:203¨C213.
9 Q2 H$ V$ D/ J0 C8 Y( ^% Y2 |" ~2 {6 \% P
Wang J, Xie LY, Allan S et al. Myc activates telomerase. Genes Dev 1998;12:1769¨C1774.0 g, q. U! e# `8 F% U: v1 i+ P' R
7 W1 A1 u D: Q) VWu KJ, Grandori C, Amacker M et al. Direct activation of TERT transcription by c-MYC. Nat Genet 1999;21:220¨C224.5 Q: e' i ]7 E7 B/ Y' h' ]: C2 n
. B4 I g. w Z/ ^+ | x; TRangarajan A, Hong SJ, Gifford A et al. Species- and cell type-specific requirements for cellular transformation. Cancer Cell 2004;6:171¨C183. |
|
发表于 2009-3-5 00:07
发表于 2015-5-24 12:15
